Skip to contents

Using modules

For the purpose of this tutorial, we are going to use the example module bio/seq. The module implements some very basic mechanisms for dealing with DNA sequences (= character strings consisting of the letters A, C, G and T).

First, we load the module:

box::use(./bio/seq)

The function box::use accepts a list of unquoted, qualified module names. Each of these module names will load a single module and make it available to the caller in some form. In the code above, we’ve loaded a single module, bio/seq. bio serves as a parent module that may group several submodules. Since the module name inside box::use starts with ./, the module location is resolved locally, i.e. relative to the path of the currently running code.

In the above, seq is the module’s proper name. bio/seq is its fully qualified name. And ./bio/seq is its use declaration.

To see the effect of this use declaration, let’s inspect our workspace:

ls()
## [1] "seq"
seq
## <module: ./bio/seq>

We have used the module’s fully qualified name to load it. But, as shown by ls, loading the module this way only introduces a single new name into the current scope, the module itself, identified by its proper (non-qualified) name.

To see which names a module exports, we use ls again, this time on the module itself:

ls(seq)
## [1] "is_valid" "revcomp"  "seq"      "table"

It appears that seq exports 4 different names. To access exported names, we use the $ operator: seq$is_valid allows us to use the first function in the list of exported names. We can also display the interactive help for individual names using the box::help function, e.g.:

box::help(seq$revcomp)

Now let’s actually use the module. The seq function inside the bio/seq module constructs a set of (optionally named) biological sequences:

s = seq$seq(
    gene1 = 'GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC',
    gene2 = 'CATAGCAACTGACATCACAGCG'
)

seq$is_valid(s)
## [1] TRUE
s
## 2 DNA sequences:
##   >gene1
##   GATTACAGATCAGCTCAGCACCTAGCA...
##   >gene2
##   CATAGCAACTGACATCACAGCG

Note how we automatically get pretty-printed (FASTA) output because the print method (which gets called implicitly here) is specialised for the 'bio/seq' S3 class in the bio/seq module (prefixing S3 classes inside modules with the full module name is a convention to avoid name clashes of S3 classes):

getS3method('print', 'bio/seq')
## function (x) {
##     box::use(stringr[trunc = str_trunc])
## 
##     if (is.null(names(x))) names(x) = paste('seq', seq_along(x))
## 
##     cat(
##         sprintf('%d DNA sequence%s:\n', length(x), if (length(x) == 1L) '' else 's'),
##         sprintf('  >%s\n  %s\n', names(x), trunc(x, 30L)),
##         sep = ''
##     )
##     invisible(x)
## }
## <environment: 0x126d47778>

The source code for `print.bio/seq` contains an interesting use declaration: it showcases an alternative way of invoking box::use, which we’ll explore now.

Attaching modules

Let’s have a look at alternative ways of using modules.

To start, let’s unload the bio/seq module …

box::unload(seq)

… and load it again, via a different route:

options(box.path = getwd())
box::use(bio/seq[revcomp, is_valid])

After unloading the already loaded module, options(box.path = …) sets the module search path: this is where box::use searches for modules. If more than one path is given, box::use searches them all until a module of matching name is found. This works analogously to how .libPaths operates on R packages.

The box::use directive can now use bio/seq instead of ./bio/seq as the module name: rather than a relative name we specify a global name. In this example we set the search path to the current working directory but in normal usage it would be a global library location, e.g. (following the XDG base directory specification) ~/.local/share/R/modules on Linux.

Note that non-local module names must be fully qualified, nested modules: box::use(foo/bar) works, box::use(bar) does not (instead, it is assumed that bar refers to a package)!

In the declaration above we use [revcomp, is_valid] to specify that the names revcomp and is_valid from the bio/seq module should be attached in the calling environment. The […] part is an attach specification: a comma-separated list of names inside the parentheses specifies which names to attach. The special symbol ... can be used to specify that all exported names should be attached. This has an effect similar to conventional package loading via library (or attaching an environment): all the attached names are now available for direct use without necessitating the seq$ qualifier:

is_valid(s)
## [1] TRUE
revcomp(s)
## 2 DNA sequences:
##   >gene1
##   GTTGCTGATAGTGCTAGGTGCTGAGCT...
##   >gene2
##   CGCTGTGATGTCAGTTGCTATG

However, unlike the attach function, module attachment happens in the current, local scope only.

Since the above code was executed in the global environment, there’s no distinction between local and global scope:

##  [1] ".GlobalEnv"        "mod:bio/seq"       "package:stats"    
##  [4] "package:graphics"  "package:grDevices" "package:utils"    
##  [7] "package:datasets"  "package:methods"   "Autoloads"        
## [10] "tools:callr"       "package:base"

Note the second item, which reads “mod:bio/seq”. But let’s now undo that, to attach (and use) the module locally instead:

detach()

seq_table = function (s) {
    box::use(./bio/seq[...])
    table(s)
}

seq_table(s)
## $gene1
##  A  C  G  T 
## 13 12  6  7 
## 
## $gene2
## A C G T 
## 8 7 4 3

Unlike above, we are now attaching all exported names instead of specifying individual names. The subsequent line of code uses the seq$table function rather than base::table (which would have a different output). And note that the seq module’s table function is not attached outside the local scope:

##  [1] ".GlobalEnv"        "package:stats"     "package:graphics" 
##  [4] "package:grDevices" "package:utils"     "package:datasets" 
##  [7] "package:methods"   "Autoloads"         "tools:callr"      
## [10] "package:base"
## s
##                 CATAGCAACTGACATCACAGCG GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC 
##                                      1                                      1

This is very powerful, as it isolates separate scopes more effectively than the attach function. What is more, modules which are used and attached inside another module remain inside that module and are not visible outside the module by default.

Nevertheless, the normal, recommended usage of a module is without an attach specification, as this makes it clearer which names are being referring to.

Writing modules

The module bio/seq, which we have used in the previous section, is implemented in the file bio/seq.r. The file seq.r is, by and large, a regular R source file, which happens to live in a directory named bio.

In fact, there are only three things worth mentioning:

  1. Documentation: functions in the module file can be documented using ‘roxygen2’ syntax. It works the same as for packages. The ‘box’ package parses the documentation and makes it available via box::help. Displaying module help requires that ‘roxygen2’ is installed.

  2. Export declarations: similar to packages, modules explicitly need to declare which names they export; they do this using the annotation comment #' @export in front of the name assignment. Again, this works similarly to ‘roxygen2’ (but does not require having that package installed).

  3. S3 functions: ‘box’ registers and exports such functions automatically as necessary, but this only works for user generics that are defined inside the same module. When overriding “known generics” (such as print), we need to register these manually via register_S3_method (this is necessary since these functions are inherently ambiguous and there is no automatic way of finding them).

Nesting modules

Modules can also form nested hierarchies. In fact, here is the implementation of bio (in bio/__init__.r: since bio is a directory rather than a file, the module implementation resides in the nested file __init__.r):

#' @export
box::use(./seq)

The submodule is specified as ./seq rather than seq: the explicitly provided relative path prevents lookup in the import search path (that we set via options(box.path = …)); instead, only the current directory (that is, the directory containing the bio module) is considered.

When applied to a box::use declaration, @export causes all names which are imported by that declaration to also be exported: any module name created by the declaration (here, seq) is exported as-is. Furthermore, any attached name is likewise exported. Refer to the box::use documentation and examples for more details on which names are exported.

Coming back to our example module, we can now use the bio module:

options(box.path = NULL) # Reset search path
box::use(./bio)
ls(bio)
## [1] "seq"
ls(bio$seq)
## [1] "is_valid" "revcomp"  "seq"      "table"
bio$seq$revcomp('CAT')
## 1 DNA sequence:
##   >seq 1
##   ATG

We could also have implemented bio as follows:

#' @export
box::use(./seq[...])

This would have made all of seq’s definitions immediately available in bio, without having to always write seq$…. This is sometimes useful, but should be employed with care: being explicit about namespaces generally increases code robustness and readability.

Code execution on loading

Modules define functions and values. To execute code when a module is loaded, put it inside a function with the name .on_load. This function is similar to the hook for the .onLoad package namespace event.

This function is executed the first time the module is loaded in an R session. Subsequent calls to box::use for that module, regardless of whether they occur in a different scope, will refer to the already loaded, cached module, and will not reload the module.

We can illustrate this by loading a module which has side-effects, info.

.on_load = function (ns) {
    message(
        'Loading module "', box::name(), '"\n',
        'Module path: "', basename(box::file()), '"'
    )
}

box::export() # Mark as a ‘box’ module.

Let’s use it:

box::use(./info)
## Loading module "info"
## Module path: "vignettes"

We have imported the module, and get the diagnostic messages. Let’s re-use the module:

box::use(./info)

… no messages are displayed. However, we can explicitly reload a module. This clears the cache, and loads the module again. This can be useful during development and debugging:

box::reload(info)
## Loading module "info"
## Module path: "vignettes"

And this displays the messages again. The reload function is a shortcut for unload followed by import (using the exact same arguments as used on the original import call).

Module helper functions

This info module also show-cases two important helper functions:

  1. box::name returns the name of the module with which it was loaded. This is especially handy because, when called outside of a module, box::name is NULL. This allows testing whether a piece of code was loaded as a module, or invoked directly (e.g. via Rscript on the command line).

  2. box::file is similar to system.file: it returns the full path to any file within the directory where a module is stored. This is useful when distributing data files with modules, which are loaded from within the module. When invoked without arguments, box::file returns the full path to the directory containing the module source file.